YÊU CẦU CÔNG NGHỆ
Vui lòng điền thông tin yêu cầu công nghệ để được tư vấn miễn phí
 
   
 
 

KẾT QUẢ TÌM KIẾM Hướng dẫn

Tìm thấy 11783 kết quả.
  • Điều trị ung thư bằng phương pháp đốt vi sóng Tìm kiếm đối tác

    1. Nguyên lý hoạt động của phương pháp đốt vi sóng và ứng dụng trong điều trị ung thư
    Vi sóng là bức xạ không ion hóa, không có đủ năng lượng mỗi lượng tử để ion hóa các nguyên tử hoặc phân tử. Vì vậy, vi sóng không làm tổn thương DNA của nhân tế bào. Vi sóng tác động bằng cách gây hiện tượng ma sát do sự tương tác với phân tử lưỡng cực chủ yếu là nước. Khi bức xạ vi sóng tương tác với phân tử, các phân tử nước tích điện dao động từ 2 đến 5 tỷ lần mỗi giây, tùy vào tần số của năng lượng vi sóng. Sự dao động phân tử nước gây ma sát và sinh nhiệt, từ đó gây hoại tử đông và chết tế bào. Mô u và nhu mô gan chứa nhiều nước rất thích hợp cho ĐVS. Sự đốt trực tiếp làm gia tăng nhiệt độ đồng thời và đồng nhất trong vài phút ở vùng phủ vi sóng. Ở ngoài trường vi sóng, nhiệt độ có thể lan truyền ra mô xung quanh theo cơ chế dẫn truyền nhiệt nhưng kém hiệu quả ở mô chứa nhiều nước như mô gan.
     
    Về cơ bản, khi nhiệt độ tăng nhẹ 42-45°C tế bào dễ tổn thương với hóa trị và tia xạ. Tổn thương tế bào không hồi phục khi tế bào bị đốt nóng đến 46°C trong 60 phút. Nhiệt độ càng cao, tổn thương tế bào không hồi phục càng nhanh. Khi nhiệt độ tăng 50-52°C thời gian gây độc tế bào chỉ sẽ rút ngắn 4-6 phút. Nhiệt độ 60°C-100°C sẽ gây ra hoại tử đông ngay lập tức với tổn thương không hồi phục men của ty lạp thể và tế bào chất. Nhiệt độ tăng hơn 105°C, mô sẽ sôi, bốc hơi và than hóa. Do đó, tiêu chí hoạt động của máy là nâng nhiệt độ vùng đốt hơn 60°C. Nguyên tắc này áp dụng cho tất cả các máy đốt dùng nhiệt.
     
    Đốt vi sóng có thể ứng dụng trong điều trị ung thư gan, ung thư phổi, u tuyến giáp, ung thư thận, umg thư xương, ung thư não…
     
    2. Hiệu quả điều trị ung thư biểu mô tế bào gan bằng phương pháp đốt vi sóng 
    Có 4 tiêu chí chính để đánh giá hiệu quả của phương pháp đốt vi sóng: Phá hủy hoàn toàn, tái phát tại chỗ, thời gian sống không bệnh tiến triển, thời gian sống thêm toàn bộ.  
     
    Phá hủy hoàn toàn
    Nhiều tác giả ghi nhận tỉ lệ phá hủy từ 80-100%. Liu F. và cs nghiên cứu ĐVS dưới hướng dẫn siêu âm cản âm ghi nhận tỉ lệ hiệu quả kỹ thuật là 99,05%. Martin R.C. và cs nghiên cứu ĐVS qua nội soi ổ bụng hay mở bụng và ghi nhận tỉ lệ phá hủy thành công 100%. Lu M.D. và cs nhận thấy điều trị UTBMTBG có kích thước ≤3cm bằng ĐVS tỉ lệ phá hủy hoàn toàn đạt 98,6% cao hơn khi điều trị khối u >3cm, tỉ lệ này chỉ 83,3% (P=0,01). Jiao D.C. và cs nghiên cứu ĐVS 2450 MHz ghi nhận tỉ lệ phá hủy hoàn toàn UTBMTBG theo các nhóm u có kích thước ≤3cm, 3,1-5 cm và 5,1-8cm lần lượt là 97,06%, 93,34% và 81,82%.
     
    Tái phát tại chỗ
    Brunello F. và cs ghi nhận tỉ lệ tái phát tại chỗ thời điểm 1 năm là 36,4%, 2 năm là 57,6%. Swan R.Z. và cs ghi nhận tỉ lệ tái phát tại chỗ sau ĐVS qua phẫu thuật là 2,9 %. Liu F. và cs xác nhận tỉ lệ tái phát tại chỗ sau ĐVS dưới hướng dẫn siêu âm cản âm 1,9%. Shirley L.A. và cs ghi nhận tỉ lệ tái phát tại chỗ 1 năm là 14% năm sau ĐVS điều trị UTBMTBG theo tiêu chuẩn Milan. Dong B. và cs ghi nhận tỉ lệ tái phát tại chỗ cao ở bệnh nhân có kích thước u > 5cm so với ≤ 5cm.
     
    Thời gian sống không bệnh tiến triển
    Lu M.D. và cs ghi nhận thời gian sống không bệnh tiến triển 1 năm, 2 năm, 3 năm, 4 năm của bệnh nhân điều trị ĐVS là 45,9%, 26,9%, 26,9%, 13,4% với thời gian sống không bệnh tiến triển trung bình 15,5 tháng. Zhang L. và cs nghiên cứu khối u ≤5cm ghi nhận tỉ lệ sống không bệnh tiến triển 1 năm , 3 năm, 5 năm ở nhóm ĐVS là 62,3%, 33,8%, 20,8%. Vogl T.J. và cs có tỉ lệ không tiến triển khá cao. Tỉ lệ sống không bệnh tiến triển 1 năm, 2 năm, 3 năm ở nhóm ĐVS là 97,2%, 94,5%, 91,7%.
     
    Thời gian sống thêm toàn bộ
    Xu H.X. và cs ghi nhận tỉ lệ sống thêm toàn bộ tích lũy sau 1 năm, 2 năm và 3 năm lần lượt là 75,6%, 58,5% và 50%. Nghiên cứu của Lu M.D. và cs ghi nhận tỉ lệ sống tích lũy 1 năm, 2 năm, 3 năm, 4 năm của nhóm ĐVS là 81,6%, 61,2%, 50,5%, 36,8%. Liang P. và cs ghi nhận tỉ lệ sống 1 năm, 2 năm, 3 năm, 4 năm và 5 năm ở 288 bệnh nhân UTBMTBG là 93%, 82%, 72%, 63% và 51% trong thời gian theo dõi trung bình 31,41±20,43 tháng.
     
    3. Tình hình áp dụng tại khoa u gan Bệnh viện Chợ Rẫy 
    Đốt vi sóng đã được ứng dụng khoa U gan từ 5/2012 cho đến nay với hàng trăm lượt đốt mỗi năm. Ban đầu chúng tôi sử dụng máy đốt vi sóng thế hệ đầu AveCure™ của hãng Medwaves, Mỹ. Hiện tại chúng tôi có máy đốt vi sóng mới của hãng …
    Áp dụng cho khối u đơn độc ≤6 cm hay ≤ 3 u, mỗi ≤3 cm, chưa di căn hay xâm lấn, không có rối loạn đông máu nặng.
     
    4. Hướng dẫn điều trị ung thư biểu mô tế bào gan hiện nay
    Trên thế giới, hướng dẫn điều trị BCLC (Barcelona Clinic Liver Cancer) là phổ biến nhất. Sau đây là sơ đồ hướng dẫn điều trị.
    Tại Việt Nam, một số bệnh viện áp dụng hướng dẫn điều trị của Bộ Y tế Việt Nam. Sau đây là sơ đồ hướng dẫn điều trị.
     
     
     
     
     
     
  • Bình Thermosiphon TLP TR Công nghệ và Thiết bị

    Thiết kế và sản xuất các bình áp lực dùng trong hệ thống lạnh được thử bền và cấp giấy chứng nhận đạt chuẩn và được phép cấp lý lịch Bình áp lực theo ủy quyền của cơ quan chức năng.
  • Đầu dò E DNA theo cơ chế signal on giúp chẩn đoán ung thư hốc miệng Tìm kiếm đối tác

    Cảm biến sinh học là thiết bị phân tích đang thu hút được nhiều sự quan tâm nghiên cứu vì những tìm năng của nó trong việc chẩn đoán và phát hiện sớm nguy cơ ung thư.Tuy nhiên, phần lớn các cảm biến E-DNA hiện nay còn nhiều hạn chế về độ nhạy. Điều đó vẫn chưa đáp ứng được các yêu cầu của việc phát hiện sớm nguy cơ ung thư khi tiến hành thử trên các mẫu dịch cơ thể như nước bọt, máu…nhằm phát hiện các chỉ tố sinh học với một nồng độ cực thấp. Để tăng độ nhạy cho cảm biến điện hóa E-DNA có nhiều yếu tố một trong những yếu tố đó chính là cấu trúc của đầu dò. Đây là yếu tố giữ vai trò quan trọng và hầu hết được các nhóm nghiên cứu tập trung nghiên cứu để tăng độ nhạy cho cảm biến E-DNA. Trong nghiên cứu này chúng tôi đã nghiên cứu và thiết kế ra đầu dò DNA hoạt động theo cơ chế thay đổi tín hiệu signal-on, cố định trên bề mặt điện cực sợi nano vàng phủ trên đế Silic với mục tiêu phát hiện chỉ tồ Interleukin-8 trong mẫu nước bọt của bệnh nhân ung thư miệng, nhằm tăng độ nhạy cho cảm biến E-DNA.
     
    Vật liệu
    -Mục tiêu là sản phẩm của phản ứng RT-PCR (với cặp mồi IF: CCAAGGAAAACTGGGTGCAG và IR: TTGGATACCACAGAGAATGAATTTTT).
    -Từ mRNA của Interleukin-8 trong mẫu bệnh phẩm nước bọt của bệnh nhân mắc bệnh ung thư hốc miệng mà không cần trải qua quá trình tinh sạch gì thêm (được cung cấp bởi trung tâm Y sinh học phân tử, Đại học Y Dược Tp Hồ Chí Minh).
    -Trình tự của DNA mục tiêu: 5’-CCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAAAAAAATTCATTCTCTGTGGTATCCAAG-3’
    -Đầu dò DNA có cấu trúc kẹp tóc sau khi được thiết kế, được tổng hợp bởi Biosearch Technologies (Novato, CA).
    -Trình tự của đầu dò 5’-MB-TTTTTGAAGACCCGA-(CH2)6-S-S-(CH2)6- AGCCCTCTTCAAAAACTTCTCCACAACCCTCTGC-3’
    -Các dung dịch hóa chất 6-Mercaptohexanol (MCH), Tris (2-carboxyethyl) phosphine hydrochloride (TCEP), postassium ferricyanide (K3Fe(CN)6), phosphate buffer saline (PBS) (pH 7.4) được cung cấp bởi (Sigma-Aldrich, St.Louis, MO). Nước cất khử ion 2 lần được sử dụng trong suốt quá trình thí nghiệm.
    -Điện cực vàng (AuNW) được sử dung là chíp các sơi nano vàng được phủ trên đế Silic với các thông số kỷ thuật (Dài: 1000µm; rộng: 2µm; cao: 60nm)
    Phương pháp
    - Chuẩn bị chíp và đầu dò
    - Chuẩn bị mục tiêu và lai hóa
    - Đo điện hóa
    Kết quả 
    Với mục đích thiết kế đầu dò có cấu trúc hoạt động theo cơ chế tín hiệu thay đổi signal-on, để gắn vào cảm biến E-DNA sợi nano vàng nhằm tăng độ nhạy cho cảm biến chúng tôi đã đạt được những kết quả sau. Thứ nhất thiết kế thành công đầu dò hoạt động theo cơ chế tín hiệu thay đổi signal-on, có cấu trúc hairpin với trình tự nhằm phát hiện đoạn DNA là sản phẩm của phản ứng RT-PCR từ mRNA của Interleukin-8. Thứ hai giới hạn phát hiện (LOD) của cảm biến E-DNA sợi nano vàng khi được gắn đầu dò hoạt động theo cơ chế tín hiệu thay đổi signal-on thông qua phương pháp CV đạt được là 25pM. Và cuối cùng với LOD 25pM đã cho thấy sự thành công trong việc tăng độ nhạy cho cảm biến E-DNA có đầu dò hairpin so với cảm biến E-DNA có đầu dò cấu trúc stem-loop đạt LOD 200pM. Điều đó đã chứng minh rằng cảm biến E-DNA đầu dò hoạt động theo cơ chế signal-on có độ nhạy cao hơn cảm biến E-DNA có đầu dò hoạt động theo cơ chế signal-off.
     
  • Cảm biến đo nhiệt độ, độ ẩm trong môi trường áp suất cao E SENSOR® SLAVE TH Hi End PRO Công nghệ và Thiết bị

    E-SENSOR® SLAVE TH Hi-End PRO WIRELESS SENSOR - CẢM BIẾN ĐO NHIỆT ĐỘ, ĐỘ ẨM KHÔNG DÂY TRONG MÔI TRƯỜNG ÁP SUẤT CAO - E-SENSOR SLAVE TH HI-END PRO
     

    Phiên bản

    Model: EPS-RP3-S1: E-Sensor® Slave TH Hi-end Pro sóng RF433Mhz
    Model: EPS-LP3-S1: E-Sensor® Slave TH Hi-end Pro sóng Lora 433Mhz

     

    Ứng dụng

    • Giám sát cảnh báo trong công nghiệp
    • Giám sát cảnh báo trong nhà máy
    • Giám sát cảnh báo trong lò sấy
    • Giám sát trong hệ thống khí nén công nghiệp
    • Giám sát cảnh báo trong máy sấy tác nhân lạnh
    • Giám sát hệ thống ống dẫn khí
    • Và ứng dụng trong nhiều lĩnh vực khác…
     
Scroll