Đầu dò E-DNA theo cơ chế signal-on giúp chẩn đoán ung thư hốc miệng

☆☆☆☆☆ ( 0 đánh giá ) 96
Liên hệ: Nguyễn Ngọc Anh Thư
Địa chỉ: 227 Đường Nguyễn Văn Cừ, Phường 4, Quận 5, Hồ Chí Minh
Điện thoại: 0989095453
Email: anhthu120927@gmail.com
Tên đơn vị: Khoa Khoa học Vật liệu - Trường Đại học Khoa học Tự nhiên - ĐHQG TPHCM

Cảm biến sinh học là thiết bị phân tích đang thu hút được nhiều sự quan tâm nghiên cứu vì những tìm năng của nó trong việc chẩn đoán và phát hiện sớm nguy cơ ung thư.Tuy nhiên, phần lớn các cảm biến E-DNA hiện nay còn nhiều hạn chế về độ nhạy. Điều đó vẫn chưa đáp ứng được các yêu cầu của việc phát hiện sớm nguy cơ ung thư khi tiến hành thử trên các mẫu dịch cơ thể như nước bọt, máu…nhằm phát hiện các chỉ tố sinh học với một nồng độ cực thấp. Để tăng độ nhạy cho cảm biến điện hóa E-DNA có nhiều yếu tố một trong những yếu tố đó chính là cấu trúc của đầu dò. Đây là yếu tố giữ vai trò quan trọng và hầu hết được các nhóm nghiên cứu tập trung nghiên cứu để tăng độ nhạy cho cảm biến E-DNA. Trong nghiên cứu này chúng tôi đã nghiên cứu và thiết kế ra đầu dò DNA hoạt động theo cơ chế thay đổi tín hiệu signal-on, cố định trên bề mặt điện cực sợi nano vàng phủ trên đế Silic với mục tiêu phát hiện chỉ tồ Interleukin-8 trong mẫu nước bọt của bệnh nhân ung thư miệng, nhằm tăng độ nhạy cho cảm biến E-DNA.
 
Vật liệu
-Mục tiêu là sản phẩm của phản ứng RT-PCR (với cặp mồi IF: CCAAGGAAAACTGGGTGCAG và IR: TTGGATACCACAGAGAATGAATTTTT).
-Từ mRNA của Interleukin-8 trong mẫu bệnh phẩm nước bọt của bệnh nhân mắc bệnh ung thư hốc miệng mà không cần trải qua quá trình tinh sạch gì thêm (được cung cấp bởi trung tâm Y sinh học phân tử, Đại học Y Dược Tp Hồ Chí Minh).
-Trình tự của DNA mục tiêu: 5’-CCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAAAAAAATTCATTCTCTGTGGTATCCAAG-3’
-Đầu dò DNA có cấu trúc kẹp tóc sau khi được thiết kế, được tổng hợp bởi Biosearch Technologies (Novato, CA).
-Trình tự của đầu dò 5’-MB-TTTTTGAAGACCCGA-(CH2)6-S-S-(CH2)6- AGCCCTCTTCAAAAACTTCTCCACAACCCTCTGC-3’
-Các dung dịch hóa chất 6-Mercaptohexanol (MCH), Tris (2-carboxyethyl) phosphine hydrochloride (TCEP), postassium ferricyanide (K3Fe(CN)6), phosphate buffer saline (PBS) (pH 7.4) được cung cấp bởi (Sigma-Aldrich, St.Louis, MO). Nước cất khử ion 2 lần được sử dụng trong suốt quá trình thí nghiệm.
-Điện cực vàng (AuNW) được sử dung là chíp các sơi nano vàng được phủ trên đế Silic với các thông số kỷ thuật (Dài: 1000µm; rộng: 2µm; cao: 60nm)
Phương pháp
- Chuẩn bị chíp và đầu dò
- Chuẩn bị mục tiêu và lai hóa
- Đo điện hóa
Kết quả 
Với mục đích thiết kế đầu dò có cấu trúc hoạt động theo cơ chế tín hiệu thay đổi signal-on, để gắn vào cảm biến E-DNA sợi nano vàng nhằm tăng độ nhạy cho cảm biến chúng tôi đã đạt được những kết quả sau. Thứ nhất thiết kế thành công đầu dò hoạt động theo cơ chế tín hiệu thay đổi signal-on, có cấu trúc hairpin với trình tự nhằm phát hiện đoạn DNA là sản phẩm của phản ứng RT-PCR từ mRNA của Interleukin-8. Thứ hai giới hạn phát hiện (LOD) của cảm biến E-DNA sợi nano vàng khi được gắn đầu dò hoạt động theo cơ chế tín hiệu thay đổi signal-on thông qua phương pháp CV đạt được là 25pM. Và cuối cùng với LOD 25pM đã cho thấy sự thành công trong việc tăng độ nhạy cho cảm biến E-DNA có đầu dò hairpin so với cảm biến E-DNA có đầu dò cấu trúc stem-loop đạt LOD 200pM. Điều đó đã chứng minh rằng cảm biến E-DNA đầu dò hoạt động theo cơ chế signal-on có độ nhạy cao hơn cảm biến E-DNA có đầu dò hoạt động theo cơ chế signal-off.
 

(Chuyển nhượng quyền sử dụng, chuyển giao toàn phần...)
- Thu hút vốn đầu tư để nghiên cứu hoàn thiện sản phẩm.

Scroll